CF121255

From Wikicell

Jump to: navigation, search

Image:Disease Image.jpg


IDENTIFIERS

dbEST Id:       19324923
EST name:       UI-HF-CB0-atm-b-04-0-UI.r1
GenBank Acc:    CF121255
GenBank gi:     33193265

CLONE INFO
Clone Id:       IMAGE:30571407 (5')
DNA type:       cDNA

PRIMERS
Sequencing:     pYX-5
PolyA Tail:     Unknown

SEQUENCE
                CACGAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTNGGG
                AAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGT
                TTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACC
                ATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTA
                CAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCA
                CAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAA
                CTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAAC
                AACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCACCTGGCCGTGAATGACTTTGAACTGG
                CACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCC
                AGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATG
                CCAATATGTTTGA

Entry Created:  Jul 24 2003
Last Updated:   Aug 6 2003

COMMENTS
                Tissue Procurement: Tim Ratlift
                cDNA Library preparation: Dr. M. Bento Soares, University of
                Iowa
                cDNA Library Arrayed by: Dr. M. Bento Soares, University of
                Iowa
                DNA Sequencing by: Dr. M. Bento Soares, University of Iowa
                Clone Distribution: Distribution information can be found at
                http://genome.uiowa.edu/distribution/humanfl.html

LIBRARY
dbEST lib id:   14129
Lib Name:       NIH_MGC_210
Organism:       Homo sapiens
Organ:          Prostate
Tissue type:    CNCAP(3)T-225 cell line
Lab host:       DH10B (T1 phage resistant)
Vector:         pT7T3 Pac
R. Site 1:      EcoR I
R. Site 2:      Not I
Description:    The library was constructed according Bonaldo, Lennon and
                Soares, Genome Research, 6:791-806, 1996. Denatured RNA was
                size fractionated on a 1% agarose gel. First strand cDNA
                synthesis was primed with oligo-dT primer containing a Not I
                site. Double strand cDNA was size selected according to mRNA
                size fraction, ligated with EcoR I adaptor, digested with
                Not I and then cloned directionally into pT7T3 Pac vector.
                The library tag sequence located between the Not I site and
                the polyA tail is CCCAC. Tissue was provided by Tim Ratlift.

SUBMITTER
Name:           Soares, MB
Lab:            Cancer Biology & Epigenomics Program
Institution:    Children's Memorial Research Center
Address:        2300 Children's Plaza, Box 220, Chicago, IL 60614-3394, USA
Tel:            773 755 6551
Fax:            773 755 6378
E-mail:         mbsoares@childrensmemorial.org

CITATIONS
PubMed ID:      8889548
Title:          Normalization and subtraction: two approaches to facilitate
                gene discovery
Authors:        Bonaldo,M.F., Lennon,G., Soares,M.B.
Citation:       Genome Res. 6 (9): 791-806 1996


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
CF121255 608 0 0 0 1 1 5 1512 + 613 4 613 chr12 132349534 2778638 2780758



Block Feature

qName blockCount blockSizes qStarts tStarts
CF121255 7 33,19,72,84,186,54,160, 4,37,57,129,213,399,453, 2778638,2779276,2779295,2779465,2779818,2780543,2780598,





Path:Human-->Reproductive System-->Male Reproductive System-->Subsidiary Gland-->Prostate-->Prostatic Carcinoma-->CF121255

Personal tools