BQ962232

From Wikicell

Jump to: navigation, search

Image:Disease Image.jpg


IDENTIFIERS

dbEST Id:       13261992
EST name:       AGENCOURT_10055105
GenBank Acc:    BQ962232
GenBank gi:     22377710

CLONE INFO
Clone Id:       IMAGE:6500370 (5')
Plate:          LLAM14053	Row:	b	Column:	19
DNA type:       cDNA

PRIMERS
PolyA Tail:     Unknown

SEQUENCE
                CGCACAGGGCGAGGGCGGCTGCGGCGCAGTCTGCAGCATGGCGTACCCGGGGCATCCTGG
                CGCCGGCGGCGGGTACTACCCAGGCGGGTATGGAGGGGCTCCCGGAGGGCCTGCGTTTCC
                CGGACAAACTCAGGATCCGCTGTATGGTTACTTTGCTGCTGTAGCTGGACAGGATGGGCA
                GATAGATGCTGATGAATTGCAGAGATGTCTGACACAGTCTGGCATTGCTGGAGGATACAA
                ACCTTTTAACCTGGAGACTTGCCGGCTTATGGTTTCAATGCTGGATAGAGATATGTCTGG
                CACAATGGGTTTCAATGAATTTAAAGAACTCTGGGCTGTACTGAATGGCTGGAGACAACA
                CTTTATCAGTTTTGACACTGACAGGAGTGGAACAGTAGACCCACAAGAATTGCAGAAGGC
                CCTGACAACAATGGGATTTAGGTTGAGTCCCCAGGCTGTGAATTCAATTGCAAAACGATA
                CAGCACCAATGGAAAGATCACCTTCGACGACTACATCGCCTGCTGCGTCAAACTGAGGGC
                TCTTACAGACAGCTTTCGAAGATGGGATACTGCTCAGCAAGGTGGTGTGAATTTCCCATA
                TGATGATTTCATTCAATGTGTCATGAGTGTTTAAATCAAGAGGAAGCTGCATGAATGTAA
                TCAACATTTCAACTGGAGCTCTCCCTTTGCCTTGTCCTCTTTGCCCTTCGGAATATGTAT
                AAAACTTACATCCACAACTTTCTCCTTACCAGCTGGTTGGAAAAGTTTATTTACTTTTAT
                GGAACAACCTGGAAGGTTTTGGGTTTTAAGCCTTGGAATAAAAAAAATTCCCTCTTGGGA
                AAACCTTTTATTAAAAGAAACCTTAGGCCTGGGTGTACCCCCCCAATTTTTAGAGAAACT
                TTTTTCCCTGGGGAACCCCATTTTTATTCTGGGC
Quality:        High quality sequence stops at base: 578

Entry Created:  Aug 19 2002
Last Updated:   Aug 21 2002

COMMENTS
                Tissue Procurement: ATCC
                cDNA Library Preparation: Life Technologies, Inc.
                cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL)
                DNA Sequencing by: Agencourt Bioscience Corporation
                Clone distribution: MGC clone distribution information can
                be found through the I.M.A.G.E. Consortium/LLNL at:
                http://image.llnl.gov

LIBRARY
dbEST lib id:   5612
Lib Name:       NIH_MGC_71
Organism:       Homo sapiens
Organ:          uterus
Tissue type:    leiomyosarcoma
Lab host:       DH10B (phage-resistant)
Vector:         pCMV-SPORT6
R. Site 1:      NotI
R. Site 2:      SalI
Description:    Cloned unidirectionally. Primer: Oligo dT. Average insert
                size 2.1 kb.

SUBMITTER
Name:           Robert Strausberg, Ph.D.
E-mail:         cgapbs-r@mail.nih.gov

CITATIONS
Title:          National Institutes of Health, Mammalian Gene Collection
                (MGC)
Authors:        NIH-MGC http://mgc.nci.nih.gov/
Year:           1999
Status:         Unpublished


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
BQ962232 735 4 0 0 5 5 8 12953 - 934 0 744 chr7 158821424 87673622 87687314



Block Feature

qName blockCount blockSizes qStarts tStarts
BQ962232 14 11,8,12,5,15,4,77,59,114,148,44,70,84,88, 190,202,211,223,229,245,250,327,386,500,648,692,762,846, 87673622,87673633,87673641,87673654,87673659,87673674,87673678,87675757,87676589,87677233,87678132,87684372,87686109,87687226,





Path:Human-->Reproductive System-->Female Reproductive System-->Uterus-->Uterine Wall-->Myometrium-->Leiomyosarcoma-->BQ962232

Personal tools