BP362909

From Wikicell

Jump to: navigation, search

Image:Normal Image.jpg


IDENTIFIERS

dbEST Id:       25629629
EST name:       BP362909
GenBank Acc:    BP362909
GenBank gi:     52292988

CLONE INFO
Clone Id:       THR09476 (5')
DNA type:       cDNA

PRIMERS
PolyA Tail:     Unknown

SEQUENCE
                AGACCATCCAAAAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGA
                AGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATG
                CCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCT
                TCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGACTCACACCACCCGG
                CAAGAACTGCTCACTATGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAA
                ACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGG
                GAAAGGGGAGAGGACTGTCCCTGAGCAGATTTAGCTGGGGGGCCGAAGGCCAGAGACCAG
                GATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAG
                TCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTG
                GATCACCCATGGCTAGACGCTGAAAACCCACCTGGTTCCGGAA

Entry Created:  Sep 17 2004
Last Updated:   Apr 24 2006

LIBRARY
dbEST lib id:   16437
Lib Name:       Sugano cDNA library, thalamus
Organism:       Homo sapiens
Tissue type:    thalamus

SUBMITTER
Name:           Yutaka Suzuki
Lab:            Department of Virology
Institution:    Institute of Medical Science, University of Tokyo
Address:        4-6-1, Shirokanedai, Minatoku, Tokyo 108-8639, Japan

CITATIONS
PubMed ID:      15342556
Title:          Sequence comparison of human and mouse genes reveals a
                homologous block structure in the promoter regions
Authors:        Suzuki,Y., Yamashita,R., Shirota,M., Sakakibara,Y.,
                Chiba,J., Mizushima-Sugano,J., Nakai,K., Sugano,S.
Citation:       Genome Res. 14 (9): 1711-1718 2004


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
BP362909 581 2 0 0 0 0 5 36066 - 583 0 583 chr18 76117153 72821350 72857999



Block Feature

qName blockCount blockSizes qStarts tStarts
BP362909 6 65,120,33,36,105,224, 0,65,185,218,254,359, 72821350,72825718,72829438,72829820,72830899,72857775,





Path:Human-->Nervous System-->Central Nervous System-->Brain-->Diencephalon-->BP362909

Personal tools