BG570520

From Wikicell

Jump to: navigation, search

Image:Normal Image.jpg


IDENTIFIERS

dbEST Id:       8283219
EST name:       602591392F1
GenBank Acc:    BG570520
GenBank gi:     13578173

CLONE INFO
Clone Id:       IMAGE:4717894 (5')
Plate:          LLCM1568	Row:	h	Column:	23
DNA type:       cDNA

PRIMERS
PolyA Tail:     Unknown

SEQUENCE
                ATGGAGTGGATGACAGCACTGGAGTTATAAACTGCATCTGCTGGAAAAAGTTGAATACTG
                AGTCTGTATCAGCTGCTCCAAGTGCAGCAAGAGAGCTCAGCTTAACCTCACAACTTAAGA
                AGCTACAAGAGACCATTGAGCAGAAAACAAAGATAGAGATCGGGGACACGATCCGAGTCA
                GAGGCAGTATCCGCACATACAGAGAAGAGCGAGAGATTCATGCCACCGCTTACTATAAAG
                TGGACGACCCAGTGTGGAACATTCAAATGGCAAGGATGCTTGAGCTGCCCACTATCTACA
                GGAAAGTTTATGACCAGCCTTTTCACAGCTCAGCCCTAGAGAAAGAAGAGGCACTAAGCA
                ATCCAGGCGCCCTGGACCTCCCCAGTCTCACGAGTTGGCTGGAGTGGAAAAAGCCAAGGA
                ATTCCTCATGGAGAACAGAGGGCAGAGCTTTTACCAGCAGGGAGCTGGAAATGGTCGAGT
                CTTGTGCTGTCCCTGTGCCAATCAGCCTGTGATTCACAGTGCCTGTCCGACCAAGTGAAT
                TTTAAGAAGGACACCACTTCCAAGGCAATTTCATAGTATATTTAAAGAATGCTATACAAA
                GTGCTGCAGGAAAAAGGACTTGTGTTCCAGAAAGATGATGGTTTCGATAAGCTATACTAT
                GTTAACCAGAGAAGACAAAGACCTGCACAGAAAGATCCACCGGATCATTCAGCAGGGACT
                GCCAGAAACCAAATCACATGGAGACAG
Quality:        High quality sequence stops at base: 742

Entry Created:  Apr 9 2001
Last Updated:   Apr 10 2001

COMMENTS
                Tissue Procurement: CLONTECH Laboratories, Inc.
                cDNA Library Preparation: CLONTECH Laboratories, Inc.
                cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL)
                DNA Sequencing by: Incyte Genomics, Inc.
                Clone distribution: MGC clone distribution information can
                be found through the I.M.A.G.E. Consortium/LLNL at:
                http://image.llnl.gov

LIBRARY
dbEST lib id:   6834
Lib Name:       NIH_MGC_77
Organism:       Homo sapiens
Organ:          lung
Lab host:       DH10B (T1 phage-resistant)
Vector:         pDNR-LIB (Clontech)
R. Site 1:      SfiI (ggccgcctcggcc)
R. Site 2:      SfiI (ggccattatggcc)
Description:    5' and 3' adaptors were used in cloning as follows: 5'
                adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor
                sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where
                B = A, C, or G and N = A, C, G, or T). Average insert size
                1.9 kb (range 0.5-4.0 kb). 12/15 colonies contained inserts
                by PCR. This library was enriched for full-length clones and
                was constructed by Clontech Laboratories (Palo Alto, CA).
                Note: this is a NIH_MGC Library.

SUBMITTER
Name:           Robert Strausberg, Ph.D.
E-mail:         cgapbs-r@mail.nih.gov

CITATIONS
Title:          National Institutes of Health, Mammalian Gene Collection
                (MGC)
Authors:        NIH-MGC http://mgc.nci.nih.gov/
Year:           1999
Status:         Unpublished


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
BG570520 708 9 0 0 9 14 8 15370 - 747 4 735 chr10 135374737 105638819 105654906



Block Feature

qName blockCount blockSizes qStarts tStarts
BG570520 15 18,54,61,13,16,34,9,29,10,23,53,43,124,162,68, 12,31,85,148,162,179,213,223,253,264,288,346,389,513,675, 105638819,105638837,105641875,105641937,105641950,105641966,105647295,105647306,105647335,105647345,105647368,105647424,105648624,105649809,105654838,





Path:Human-->Respiratory System-->Lung-->BG570520

Personal tools