BE707769

From Wikicell

Jump to: navigation, search

Image:Disease Image.jpg


IDENTIFIERS

dbEST Id:       5967645
EST name:       QV3-HT0544-190600-225-d03
GenBank Acc:    BE707769
GenBank gi:     10096034

CLONE INFO
DNA type:       cDNA

PRIMERS
Sequencing:     puc 18 forward
PolyA Tail:     Unknown

SEQUENCE
                GAGCTCGGTCCCTCGTTGCGTGGCCGTTGGGTGGCTCTTTGGGAACTTGCTTGAGCCTAG
                GAGGTTGAGTTCGCAGTGAGCCATGGTTGCACCACTGTATTCCACCAGGCGCCTTCTTCT
                TGGCCTTGGGGACTCTGCCCCCCTCCTCACCACTGGCATCACTGGCATCGGACGACATCT
                CCAGGTCGTCCTCCAGGTCGTGGATGCGCAGCTCGCTCGCCTTCCTGCGGCCACGTTTCT
                CCTTCTCCTCCTCATCCTCGTCCTGGTCCTGATCCTTGAGCCGCCGCTGCTGCATGATGC
                TGAAGTGGTTCAGCACCTTGTTCCTCCTCTCCCACTCCTCCACGAGCCGGCGCTTTGTGA
                GAGCTAA
Quality:        High quality sequence starts at base: 55
Quality:        High quality sequence stops at base: 367

Entry Created:  Sep 12 2000
Last Updated:   Sep 12 2000

COMMENTS
                This sequence was derived from the FAPESP/LICR Human Cancer
                Genome Project. This entry can be seen in the following URL

LIBRARY
dbEST lib id:   5206
Lib Name:       HT0544
Organism:       Homo sapiens
Organ:          head_neck
Develop. stage: Adult
Vector:         puc18
R. Site 1:      SmaI
R. Site 2:      SmaI
Description:    A mini-library was made by cloning products derived from
                ORESTES PCR (U.S. Letters Patent application No. 196,716 -
                Ludwig Institute for Cancer Research) profiles into the pUC
                18 vector. Reverse transcription of tissue mRNA and cDNA
                amplification were performed under low stringency
                conditions.

SUBMITTER
Name:           Simpson A.J.G.
Lab:            Laboratory of Cancer Genetics
Institution:    Ludwig Institute for Cancer Research
Address:        Rua Prof. Antonio Prudente 109, 4 andar, 01509-010, Sao
                Paulo-SP, Brazil
Tel:            +55-11-2704922
Fax:            +55-11-2707001
E-mail:         asimpson@ludwig.org.br

CITATIONS
PubMed ID:      10737800
Title:          Shotgun sequencing of the human transcriptome with ORF
                expressed sequence tags
Authors:        Dias Neto,E., Garcia Correa,R., Verjovski-Almeida,S.,
                Briones,M.R., Nagai,M.A., da Silva,W. Jr., Zago,M.A.,
                Bordin,S., Costa,F.F., Goldman,G.H., Carvalho,A.F.,
                Matsukuma,A., Baia,G.S., Simpson,D.H., Brunstein,A.,
                deOliveira,P.S., Bucher,P., Jongeneel,C.V., O'Hare,M.J.,
                Soares,F., Brentani,R.R., Reis,L.F., de Souza,S.J.,
                Simpson,A.J.
Citation:       Proc. Natl. Acad. Sci. U.S.A. 97 (7): 3491-3496 2000


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
BE707769 221 0 0 0 0 0 1 1460 + 367 107 328 chr19 63811651 6332827 6334508



Block Feature

qName blockCount blockSizes qStarts tStarts
BE707769 2 34,187, 107,141, 6332827,6334321,





Path:Human-->Endocrine System-->Endocrine-->Thyroid Gland-->Thyroid Tumor--> BE707769

Personal tools